View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7731_high_6 (Length: 219)
Name: NF7731_high_6
Description: NF7731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7731_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 126
Target Start/End: Complemental strand, 40750079 - 40749978
Alignment:
| Q |
25 |
gtcaggtgatttgtagagtaatatatgtagagattgagattcgaagcttagacaacctatcttttcatcttaaaaaatgtgaagttttagtcactaaact |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40750079 |
gtcaggtgatttgtagagtaatatatgtagagattgaaattcaaagcttagacaacctatcttttcattttaaaaaatgtgaagttttagtcactaaact |
40749980 |
T |
|
| Q |
125 |
ac |
126 |
Q |
| |
|
|| |
|
|
| T |
40749979 |
ac |
40749978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 182
Target Start/End: Complemental strand, 40749959 - 40749920
Alignment:
| Q |
143 |
gacagctttttgaatgttggtgttacttgtcactgttatg |
182 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
40749959 |
gacagctttttggatgttggtgttacttgtcacggttatg |
40749920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University