View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7731_low_10 (Length: 249)
Name: NF7731_low_10
Description: NF7731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7731_low_10 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 138422 - 138303
Alignment:
| Q |
1 |
ttgagccgttctttttcgattcatgtcagcattgcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttcg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
138422 |
ttgaaccgttctttttcgattcatgtcagcattgcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttcg |
138323 |
T |
 |
| Q |
101 |
atataataaacgtgctcctg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
138322 |
atataataaacgtgctcctg |
138303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 18341935 - 18342054
Alignment:
| Q |
1 |
ttgagccgttctttttcgattcatgtcagcattgcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttcg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18341935 |
ttgaaccgttctttttcgattcatgtcagcattgcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttcg |
18342034 |
T |
 |
| Q |
101 |
atataataaacgtgctcctg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18342035 |
atataataaacgtgctcctg |
18342054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 22101211 - 22101330
Alignment:
| Q |
1 |
ttgagccgttctttttcgattcatgtcagcatt-gcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttc |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22101211 |
ttgaaccgttctttttcgattcatgtcagcatttgcgtatcaaagttatcatatcgacgatagtatctttacccacgatagattattgctccttactttc |
22101310 |
T |
 |
| Q |
100 |
gatataataaacgtgctcct |
119 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
22101311 |
ggtataataaacgtgctcct |
22101330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 13168566 - 13168685
Alignment:
| Q |
1 |
ttgagccgttctttttcgattcatgtcagcattgcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttcg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168566 |
ttgaaccgttctttttcgattcatgtcagcattgcgtatcaaagttagcatatcagcgatagtatctttacccacgatagattattgctccttactttcg |
13168665 |
T |
 |
| Q |
101 |
atataataaacgtgctcctg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13168666 |
atataataaacgtgctcctg |
13168685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University