View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7732_low_17 (Length: 237)
Name: NF7732_low_17
Description: NF7732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7732_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 67 - 221
Target Start/End: Complemental strand, 51511829 - 51511675
Alignment:
| Q |
67 |
tgagtgagtcacacattttcaaatattaaaacaagactaactctcacggaacctctcatattcacaagtcacaacacaaggattcatttttggaacaaaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51511829 |
tgagtgagtcacacattttcaaatattaaaacaagactaactctcacggaacctctcatattcacaagtcacaacacaaggattcattttaggaacaaaa |
51511730 |
T |
|
| Q |
167 |
acaacaaacaaccttgtaagaatcacgtgttcttttagcagttgttatagttcat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51511729 |
acaacaaacaaccttgtaagaatcacgtgttcttttagcagttgttatagttcat |
51511675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University