View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7733_high_4 (Length: 359)
Name: NF7733_high_4
Description: NF7733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7733_high_4 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 41440663 - 41440328
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttattttatttatttggtataatagaagaatctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
41440663 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttttttattttatttattcggtataagagaagaatctcaa |
41440564 |
T |
 |
| Q |
101 |
atccaaaacttcacatacagcaaaacagaataaatacataaataaaagaaaccactatcaaacaaacagcagtttgattctacattttcctaagttcaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41440563 |
atccaaaacttcacatacagcaaaacagaataaatacataaataaaagaaatcactatcaaacaaacagcagtttgattctacattttcctaagttcaat |
41440464 |
T |
 |
| Q |
201 |
gactagatacgtttcacaatgacctataacaaataggtccgttaacgatgacaaataaccaatggcctatcacaataagaagcaatgttatcaatggccg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41440463 |
gactagatacgtttcacaatgacctataacaaataggtccgttaacgatgacaaataaccaatggcctatcacaataagaagcaatgttatcaatggccg |
41440364 |
T |
 |
| Q |
301 |
agagcaaaagatccgacatattgcgctgccatcctt |
336 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
41440363 |
agagcaaaaaatccgacatattgtgctgccatcctt |
41440328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 27474377 - 27474438
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
27474377 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
27474438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 45402193 - 45402244
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccgg |
52 |
Q |
| |
|
||||||| ||||||||| |||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
45402193 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgg |
45402244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4349735 - 4349797
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttta |
63 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4349735 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
4349797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4430060 - 4430015
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtg |
46 |
Q |
| |
|
||||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
4430060 |
atggtggaacccctttctggatcctgtgtatgcgggagctttagtg |
4430015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 42304268 - 42304207
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
42304268 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttt |
42304207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 46248014 - 46247953
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
46248014 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcccttt |
46247953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 33594191 - 33594147
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtg |
46 |
Q |
| |
|
|||||| ||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtg |
33594147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 43768237 - 43768297
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
|||||| ||||||||| |||| ||| |||| ||||||||||| || ||||| ||||||||| |
|
|
| T |
43768237 |
tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttt |
43768297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 59053 - 59117
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatt |
65 |
Q |
| |
|
||||||| ||||||||| |||||||| ||||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
59053 |
atggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccctttatt |
59117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 3771414 - 3771474
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
3771414 |
tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttt |
3771474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 25622534 - 25622595
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
25622534 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 12575721 - 12575658
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttat |
64 |
Q |
| |
|
||||||| |||||||||| ||| ||| |||||| |||||||| ||| ||||| ||||||||||| |
|
|
| T |
12575721 |
atggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgccctttat |
12575658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 16957388 - 16957449
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
16957388 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
16957449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 38879657 - 38879718
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
38879657 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38879718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 6966175 - 6966226
Alignment:
| Q |
11 |
cccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
6966175 |
cccttcccggactctgtgtatgcaggagcattagtgaaccggactgcccttt |
6966226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 36816443 - 36816384
Alignment:
| Q |
3 |
ggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||| || ||||||| ||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
36816443 |
ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttt |
36816384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 44363191 - 44363128
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttat |
64 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
44363191 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttat |
44363128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 20639719 - 20639653
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattta |
67 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
20639719 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttta |
20639653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 38755969 - 38755907
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttta |
63 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
38755969 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
38755907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 50555717 - 50555651
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattta |
67 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||| |||| ||||||| ||||| ||||||||| |||| |
|
|
| T |
50555717 |
atggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttttttta |
50555651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 10277818 - 10277757
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
|||||| |||||||||| |||| ||| |||||||||| | |||||||||||| |||||||| |
|
|
| T |
10277818 |
atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgcccttt |
10277757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 63
Target Start/End: Complemental strand, 30690236 - 30690175
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttta |
63 |
Q |
| |
|
|||||| ||||||||| ||| ||| ||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
30690236 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttta |
30690175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 51865099 - 51865038
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| |||||||| ||| ||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
51865099 |
atggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgcccttt |
51865038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 54
Target Start/End: Original strand, 19027923 - 19027975
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggac |
54 |
Q |
| |
|
|||||| ||||||| | |||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
19027923 |
tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccggac |
19027975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 33836548 - 33836480
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttatt |
69 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| | ||| |||||||| |||||| |
|
|
| T |
33836548 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttttttatt |
33836480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 16)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 33368862 - 33368815
Alignment:
| Q |
170 |
cagtttgattctacattttcctaagttcaatgactagatacgtttcac |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
33368862 |
cagtttgattctacattttcccaagttcaatgactaaatatgtttcac |
33368815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 244 - 282
Target Start/End: Complemental strand, 33368776 - 33368738
Alignment:
| Q |
244 |
aacgatgacaaataaccaatggcctatcacaataagaag |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33368776 |
aacgatgacaaataaccaatggcctatcacaatcagaag |
33368738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 99326 - 99281
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtg |
46 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
99326 |
atggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 14530394 - 14530459
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattt |
66 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
14530394 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttattt |
14530459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 44643597 - 44643658
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| |||| ||| |||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
44643597 |
atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgcccttt |
44643658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 19185804 - 19185760
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagt |
45 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
19185804 |
atggtggaaccccttcctggaccctgcgtatgcgggagctttagt |
19185760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 93 - 125
Target Start/End: Complemental strand, 33368922 - 33368890
Alignment:
| Q |
93 |
aatctcaaatccaaaacttcacatacagcaaaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33368922 |
aatctcaaatccaaaacttcacatacagcaaaa |
33368890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 11514519 - 11514570
Alignment:
| Q |
11 |
cccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
11514519 |
cccttcccagaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
11514570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 10546237 - 10546303
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattta |
67 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
10546237 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttta |
10546303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 9671253 - 9671314
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
9671253 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
9671314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 10543774 - 10543835
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
10543774 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 32781349 - 32781308
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagcttt |
42 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||| |
|
|
| T |
32781349 |
atggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 33795359 - 33795400
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagcttt |
42 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||| |
|
|
| T |
33795359 |
atggtgggaccccttcccagaccctgtgtatgcgggagcttt |
33795400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 17380294 - 17380231
Alignment:
| Q |
5 |
tggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttatt |
69 |
Q |
| |
|
|||||||||||||| ||| ||| | ||||||||||||| ||| ||||| || ||||||||||||| |
|
|
| T |
17380294 |
tggaaccccttcctggaccctgcggatgcgggagcttt-gtgcaccgggcttccctttatttatt |
17380231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 31158500 - 31158456
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagt |
45 |
Q |
| |
|
||||||| ||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
31158500 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagt |
31158456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctt |
61 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 35261753 - 35261814
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| |||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
35261753 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
35261814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 44530223 - 44530274
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccgg |
52 |
Q |
| |
|
||||||| |||||||||| ||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
44530223 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg |
44530274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 35107372 - 35107311
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| |||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
35107372 |
atggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt |
35107311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 46
Target Start/End: Complemental strand, 3469228 - 3469191
Alignment:
| Q |
9 |
accccttcctagactctgtgtatgcgggagctttagtg |
46 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3469228 |
accccttcctagaccctgtgtatgcgggagctttagtg |
3469191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 61
Target Start/End: Original strand, 18747562 - 18747621
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctt |
61 |
Q |
| |
|
|||||| |||||||||| || ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18747562 |
tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 33871971 - 33871926
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtg |
46 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
33871971 |
atggtgggaccccttcccagaccctgtgtatgcgagagctttagtg |
33871926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 45018983 - 45018939
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtg |
46 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
45018983 |
tggtggaaccccttcccggaccctgcgtatgcgggagctttagtg |
45018939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 6808469 - 6808530
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
6808469 |
atggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
6808530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 13628309 - 13628256
Alignment:
| Q |
9 |
accccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| || ||| |||||||| |
|
|
| T |
13628309 |
accccttcctagactctgcgtatgcgggagttttagtgcactggattgcccttt |
13628256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 18277254 - 18277203
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccgg |
52 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
18277254 |
atggtgggaccccttcctagactctacgtatgcgggagctttactgcaccgg |
18277203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 12885987 - 12886048
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| |||| ||| ||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
12885987 |
atggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
12886048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 13267799 - 13267860
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| |||||||||| ||| ||| |||||||||||||| |||| ||||| |||||||| |
|
|
| T |
13267799 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt |
13267860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 29355916 - 29355855
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
29355916 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
29355855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 19731099 - 19731155
Alignment:
| Q |
2 |
tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcc |
58 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
19731099 |
tggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 10484669 - 10484616
Alignment:
| Q |
9 |
accccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
10484669 |
accccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10484616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 13628851 - 13628790
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
13628851 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
13628790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 40272873 - 40272812
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
40272873 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40272812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 53996626 - 53996565
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
53996626 |
atggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttt |
53996565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 54484787 - 54484848
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt |
62 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
54484787 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
54484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 46905 - 46972
Alignment:
| Q |
1 |
atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttat |
68 |
Q |
| |
|
||||||| ||||||||| ||| ||| ||||||||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
46905 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttttat |
46972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University