View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7733_high_7 (Length: 314)
Name: NF7733_high_7
Description: NF7733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7733_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 31566610 - 31566405
Alignment:
| Q |
1 |
tcagataatcgaagagcataagaacaccaacatgactggtttcacaagaacaaacgtgtttaaacctagatcaaatgataagtccaacacattagtaacc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31566610 |
tcagataatcgaagagcacaagaacaccaacatgactggtttcacaagaacaaacgtgtttaaacctagatcaaatgataagtccaacacattagtaacc |
31566511 |
T |
 |
| Q |
101 |
aaacaaccctttcgagctaatagaacaagagcctttcaggttttagaatctgaatcaccacaaagtaggtcgcatttgttatcactcaatctctgatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31566510 |
aaacaaccctttcgagctaatagaacaagagcctttcaggttttagaatctgaatcaccacaaagtaggtcgcatttgttatcactcaatctctgatcaa |
31566411 |
T |
 |
| Q |
201 |
gaatag |
206 |
Q |
| |
|
|||||| |
|
|
| T |
31566410 |
gaatag |
31566405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University