View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7733_low_2 (Length: 585)
Name: NF7733_low_2
Description: NF7733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7733_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 541; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 541; E-Value: 0
Query Start/End: Original strand, 1 - 569
Target Start/End: Original strand, 26343253 - 26343821
Alignment:
| Q |
1 |
gttacctcgaagcggtgccgtggacggaggaagaagaaaaccgagtcgttaacctaattccatttctaagcgaagaagaatcaaaggaactcattgctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26343253 |
gttacctcgaagcggtgccgtggacggaggaagaagaaaaccgagtcgttaacctaattccatttctaagcgaagaagaatcaaaggaactcattgctag |
26343352 |
T |
 |
| Q |
101 |
gatttcacctgtaggagaaaatgcttgtgaagaaatgctggaaggtttaatttcatcggcgatgaacaattacggtaacaccgcattcgtgaaagcgttt |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26343353 |
ggtttcacctgtaggagaaaatgcttgtgaagaaatgctggaaggtttaatttcatcggcgatgaacaattacggtaacaccgcattcgtgaaagcgttt |
26343452 |
T |
 |
| Q |
201 |
gtagggaagatattaagggatgtatcttcgagggaaacagtgaagagggttttggagaaagcgtttaggggcagtttgaaaacggtgaagcaatcattgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26343453 |
gtagggaagatattaagggatgtatcttcgagggaaacggtgaagagggttttggagaaagcgtttagggggagtttgaaaacggtgaagcaatcattgg |
26343552 |
T |
 |
| Q |
301 |
aggattattcgagtccggtttttagaggggatcataatgaaaatgaaactgaagcaatgcagaaggtgaatttgcacaaggcttctactattgggaagca |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26343553 |
aggattattcgagtccggtttttagaggggatcataatgaaaatgaaacggaagcaatgcagagggtgaatttgcataaggcttctactattgggaagca |
26343652 |
T |
 |
| Q |
401 |
tttgttatggcttgtggagaggatggttgagcttagggttgcagatgcagcagtgcgggaatggagtgagcaagaagcttttacgggtgatttgaagaag |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26343653 |
tttgttatggcttgtggagaggatggttgagcttagggttgcagatgcagccgtgcgggaatggagtgagcaagaagcttttacgggtgatttgaagaag |
26343752 |
T |
 |
| Q |
501 |
gcgtttggggaagatgcatggaggaatatcgttcccggtcttcctgctgttattcttaggtgtacttct |
569 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26343753 |
gcgtttggggaagatgcatggaggaatatcgttcccggtcttcctgctgttattcttaggtgtacttct |
26343821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University