View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7733_low_9 (Length: 279)
Name: NF7733_low_9
Description: NF7733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7733_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 53660722 - 53660983
Alignment:
| Q |
18 |
tgtagcagaccaaaatattggcagaactggaaaaaacataatgcatattaaatttcaaagctatatcataaccatctcaatagttagtttatcatccatt |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660722 |
tgtagcagaccaaaatattagcagaactggaaaaaacataatgcatattaaatttcaaagctatatcataaccatctcaatagttagtttatcatccatt |
53660821 |
T |
|
| Q |
118 |
ccacataacctcatagcatctaactgtagtctcgtaccaagttttgaattcctctcaaattctcatcctaacccgtgcaaagtgcaaactctatttttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660822 |
ccacataacctcatagcatctaactgtagtctcgtaccaagttttgaattcctctcaaattctcatcctaacccgtgcaaagtgcaaactctatttttaa |
53660921 |
T |
|
| Q |
218 |
agaacttgaaacttattttaatactttgtggtaataaacagagaggatactcaatcacttac |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660922 |
agaacttgaaacttattttaatactttgtggtaataaacagagaggatactcaatcacttac |
53660983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University