View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7734_low_3 (Length: 271)
Name: NF7734_low_3
Description: NF7734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7734_low_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 7088810 - 7088540
Alignment:
| Q |
1 |
ggcttatcaggtaaattaggaagaagtcttgaaaaattgcaacatttagtaacattatcactttcacacaacaatttcagtggaactattagtccttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7088810 |
ggcttatcaggtaaattaggaagaagtcttgaaaaattgcaacatttagtaacattatcactttcacacaacaatttcagtggaactattagtccttcac |
7088711 |
T |
 |
| Q |
101 |
ttacactttccaacactcttcaaaaactaaaccttagtcacaactcattttctggtccattacctctttcttttgtcaacattagttcaataaggttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7088710 |
ttacactttccaacactcttcaaaaactaaaccttagtcacaactcattttctggtccattacctctttcttttgtcaacatgagttcaataaggttcat |
7088611 |
T |
 |
| Q |
201 |
cgatctctcgcataattcattcacgggacaaatgcctgatagtttctttgagaattgtttctcccttcgtc |
271 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7088610 |
tgatctctcgcataattcgttcgcgggacaaatgcctgatggtttcttcgagaattgtttctcccttcgtc |
7088540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University