View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7735_low_9 (Length: 212)
Name: NF7735_low_9
Description: NF7735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7735_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 4674775 - 4674952
Alignment:
| Q |
16 |
aatactatggctgtaactggtgatgctttaagagatggatcacttggcttgttaaaaccatttgtaacaatgtccactgcatttagagttgcaattgcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674775 |
aatactatggctgtaactggtgatgctttaagagatggatcacttggcttgttaaaaccatttgtaacaatgtccactgcatttagagttgcaattgcag |
4674874 |
T |
|
| Q |
116 |
cacctaaactgtgacctgttatagttatgcttatttcttcattcttgtatttttccactaaccttcttacctcactta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4674875 |
cacctaaactgtgacctgttatagttatgcttatttcttcattcttgtatttctccaccaaccttcttacctcactta |
4674952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 165
Target Start/End: Original strand, 34548233 - 34548310
Alignment:
| Q |
88 |
tccactgcatttagagttgcaattgcagcacctaaactgtgacctgttatagttatgcttatttcttcattcttgtat |
165 |
Q |
| |
|
||||||| | ||| |||||||| |||| |||| |||||||| || |||| ||||||||| |||||||||||||||||| |
|
|
| T |
34548233 |
tccactgaacttatagttgcaagtgcaccacccaaactgtgtccagttacagttatgctaatttcttcattcttgtat |
34548310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University