View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_high_42 (Length: 288)
Name: NF7737_high_42
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 93 - 173
Target Start/End: Original strand, 26860363 - 26860443
Alignment:
| Q |
93 |
tatcacttttttaaacatgttaagacatatgtaattaaactgaaacatggattagtcggtggtgaatgcttgagaccttga |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26860363 |
tatcacttttttaaacatgttaagacatatgtaattaaactgaaacatggattagtcagtggtgaatgcttgagaccttga |
26860443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 92
Target Start/End: Original strand, 26860270 - 26860333
Alignment:
| Q |
30 |
atttaaagtctctgttcataactgaaattatgcttgtgcta-ttttttataatgaatttactgt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||| |
|
|
| T |
26860270 |
atttaaagtctctgttcataactgaaattatgcttgtgctatttttttttaattaatttactgt |
26860333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 26860444 - 26860487
Alignment:
| Q |
204 |
gctagtggattgtggaattggtctctcgaattagtcggtcctag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26860444 |
gctagtggattgtggaattggtctctcgaattagtcggtcctag |
26860487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University