View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7737_high_54 (Length: 249)

Name: NF7737_high_54
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7737_high_54
NF7737_high_54
[»] chr3 (1 HSPs)
chr3 (7-246)||(26859999-26860238)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 26859999 - 26860238
Alignment:
7 agcagagatggaggaagatggttcgaattcaaaccgccgcacgtcaggccgaacacgaaaagttgcatccaaaatggtcgccgcacttgctagctccgac 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26859999 agcagagatggaggaagatggttcgaattcaaaccgccgcacgtcaggccgaacacgaaaagttgcatccaaaatggtcgccgcacttgctagctccgac 26860098  T
107 aaccgtacccaggctgctcttgcacggttggatgctttggagaatgacaatgctggatttgaagttgcagatcctaatcttgatgatgacgaagcttctc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
26860099 aaccgtacccaggctgctcttgcacggttggatgctttggagaatgacaatgctggatttgaagttgtagatcctaatcttgatgatgacgaagcttctc 26860198  T
207 ttgatgatgatgatcaaggttaggttcttttttctgatta 246  Q
    ||||||||||||||||||||||||||||||||||||||||    
26860199 ttgatgatgatgatcaaggttaggttcttttttctgatta 26860238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University