View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_high_54 (Length: 249)
Name: NF7737_high_54
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_high_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 26859999 - 26860238
Alignment:
| Q |
7 |
agcagagatggaggaagatggttcgaattcaaaccgccgcacgtcaggccgaacacgaaaagttgcatccaaaatggtcgccgcacttgctagctccgac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26859999 |
agcagagatggaggaagatggttcgaattcaaaccgccgcacgtcaggccgaacacgaaaagttgcatccaaaatggtcgccgcacttgctagctccgac |
26860098 |
T |
|
| Q |
107 |
aaccgtacccaggctgctcttgcacggttggatgctttggagaatgacaatgctggatttgaagttgcagatcctaatcttgatgatgacgaagcttctc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26860099 |
aaccgtacccaggctgctcttgcacggttggatgctttggagaatgacaatgctggatttgaagttgtagatcctaatcttgatgatgacgaagcttctc |
26860198 |
T |
|
| Q |
207 |
ttgatgatgatgatcaaggttaggttcttttttctgatta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26860199 |
ttgatgatgatgatcaaggttaggttcttttttctgatta |
26860238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University