View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_high_61 (Length: 228)
Name: NF7737_high_61
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 210
Target Start/End: Complemental strand, 42955025 - 42954825
Alignment:
| Q |
12 |
atattattctaggttaacaatgtcaaacatggtaataaataattacaatactattttgatcaataattgcttataacttggagttaggannnnnnnnn-- |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42955025 |
atattattctaggttaacaatgtcaaacatggtaataaataattacaatactattttgatcaatatttgcttataacttggagttaggattttttttttt |
42954926 |
T |
|
| Q |
110 |
gaaagacttggagttaggattgtgaagatgatattgctcctttattattgatctttcacttatccgaagctcgatcataccatgatcgaaaatatcgtta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42954925 |
gaaagacttggagttaggattgtgaagatgatattgctcctttattattgatctttcacttatccgaagctcgatcatacgatgatcgaaaatatcgtta |
42954826 |
T |
|
| Q |
210 |
t |
210 |
Q |
| |
|
| |
|
|
| T |
42954825 |
t |
42954825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University