View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_high_65 (Length: 220)
Name: NF7737_high_65
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_high_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 204
Target Start/End: Complemental strand, 563635 - 563443
Alignment:
| Q |
12 |
tggtgttgtagaaaaagttgaaattgtaaatgtcttgaagaggttaattgtagatgaaggaattgagattcgtggaagaatcaaagtactaaaagatgct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
563635 |
tggtgttgtagaaaaagttgaaattgtaaatgtcttgaagaggttaattgtagatgaaggaattgagattcgtagaagaatgaaagtactaaaagatgct |
563536 |
T |
|
| Q |
112 |
gctgctaatgcaatgaaagtagatggatcttccataatcattatgtcccaattggtcaccaaatggacaaagatggaaggttttgatgaaaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
563535 |
gctgctaatgcaatgaaagtagatggatcttccataatcactatgtcccaattggtcacaaaatggacaaagatggaaggttttgatgaaaat |
563443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University