View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_45 (Length: 333)
Name: NF7737_low_45
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 43984139 - 43983859
Alignment:
| Q |
19 |
agagaagagtaggagtccaagagaattgagtgatatctgcataagatgccgtgtctgattttgctacatcttttttggtttagcacgatattggtaagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43984139 |
agagaagagtaggagtccaagagaattgagtgatatctgcataagatgccgtgtctgattttgctacatcttttttggtttagcacgatattggtacgaa |
43984040 |
T |
|
| Q |
119 |
attttcaccgcttagcagtaattaatttcgttgggaaatatgtgagagtcaataattaaactctgaaccttaggtttaaggagctcaaatctcttattac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
43984039 |
attttcaccgcttagcagtaattaatttcgttgggaaatatgtgagagtcaataattaaactctgaaccttatgtttaaggagcttaaatctcttattac |
43983940 |
T |
|
| Q |
219 |
ttggattaattatacttttgtatttggcattgtttatgtttaataaaagtcattttattttggatcaattgaaggattgta |
299 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43983939 |
ttggatcaattatacttttgtatttggcattgtttatgtttaataaaagtcattttattttggatcaattgaaggattgta |
43983859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University