View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7737_low_53 (Length: 288)

Name: NF7737_low_53
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7737_low_53
NF7737_low_53
[»] chr3 (3 HSPs)
chr3 (93-173)||(26860363-26860443)
chr3 (30-92)||(26860270-26860333)
chr3 (204-247)||(26860444-26860487)


Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 93 - 173
Target Start/End: Original strand, 26860363 - 26860443
Alignment:
93 tatcacttttttaaacatgttaagacatatgtaattaaactgaaacatggattagtcggtggtgaatgcttgagaccttga 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
26860363 tatcacttttttaaacatgttaagacatatgtaattaaactgaaacatggattagtcagtggtgaatgcttgagaccttga 26860443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 92
Target Start/End: Original strand, 26860270 - 26860333
Alignment:
30 atttaaagtctctgttcataactgaaattatgcttgtgcta-ttttttataatgaatttactgt 92  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||    
26860270 atttaaagtctctgttcataactgaaattatgcttgtgctatttttttttaattaatttactgt 26860333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 26860444 - 26860487
Alignment:
204 gctagtggattgtggaattggtctctcgaattagtcggtcctag 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
26860444 gctagtggattgtggaattggtctctcgaattagtcggtcctag 26860487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University