View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_54 (Length: 282)
Name: NF7737_low_54
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 38974412 - 38974668
Alignment:
| Q |
18 |
taaataactacgatccacagtccacaagttggatggatgggattactctcatcttgataaggtgaatccattttcctctctagtatggatgatgctaatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38974412 |
taaataactacgatccacagtccacaagttggatggatgggcttactctcatcttgataaggtgaatccattttcctctctagtatggatgatgctaatg |
38974511 |
T |
|
| Q |
118 |
taaacttatttgataatatatgaaaattacatatttcattttattctagacaagtcattggcatatgattactcaacaannnnnnnnatgactggacggg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
38974512 |
taaacttatttgataatatatgaaaattacatatttcattttattctagacaagtcattagcatatgattactccacaaatttttttatgactggacggg |
38974611 |
T |
|
| Q |
218 |
ctttatacatagcctttaaagggactaatcttgacaaggtgaaaccactttcttctc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38974612 |
ctttatacatagcctttaaagggactaatcttgacaaggtgaaaccactttcttctc |
38974668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University