View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_61 (Length: 256)
Name: NF7737_low_61
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 21 - 251
Target Start/End: Complemental strand, 33536183 - 33535953
Alignment:
| Q |
21 |
agacggtttatgtagcgaattgtggtgattcgagggcggtgatagcggagaagaaagggaaagatggtgatattgttgcagttgatttgtctattgatca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33536183 |
agacggtttatgtagcgaattgtggtgattcgagggcggtgatagcggagaagaaagggaaagatggtgatattgttgcagttgatttgtctattgatca |
33536084 |
T |
|
| Q |
121 |
gacaccttatagagttgatgagttagaaagagtgaaactttgtggtgctagggttctaactttggatcaaattgaagggttaaagaatcctgaagttccg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33536083 |
gacaccttatagagttgatgagttagaaagagtgaaactttgtggtgctagggttctaactttggatcaaattgaagggttaaagaatcctgaagttccg |
33535984 |
T |
|
| Q |
221 |
tgttggggtagtgatgaagaaggtgatgatg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33535983 |
tgttggggtagtgatgaagaaggtgatgatg |
33535953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University