View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_62 (Length: 256)
Name: NF7737_low_62
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 21253852 - 21254092
Alignment:
| Q |
12 |
gtttggagtttaccagtcctctaaaatgtgcaacggtcgttccttaatagctgcacttgtttctgatgcttgctgccattggtttaggttccgactcttc |
111 |
Q |
| |
|
||||| ||||| || |||||||||||| ||| | | |||||||||| ||||||||| |||||||| ||| ||||||||| ||||||||| |||||||| |
|
|
| T |
21253852 |
gtttgcagtttcccggtcctctaaaatatgccatgcccgttccttaacagctgcactattttctgatactttctgccattgctttaggttctgactcttc |
21253951 |
T |
 |
| Q |
112 |
cataaactccttccttaacagatctgtttgataaaaattgtttcctatacgtgctacaaaatatgaaaacacgcagcatgtgccgtatgaaatagctgcg |
211 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21253952 |
cataaactcgttccttaacagatttgtttgataaaacttgtttcctatacgtgctgcaaaatatgaaaactcgcagcatgtgccgtatgaaatagctgcg |
21254051 |
T |
 |
| Q |
212 |
cagccatatcaactgttttccatatgccagcagctctccat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21254052 |
cagccatatcaactgttttccatatgccagcagctctccat |
21254092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University