View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_64 (Length: 249)
Name: NF7737_low_64
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_64 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 33535966 - 33535722
Alignment:
| Q |
1 |
agaaggtgatgatggcgatcctcctaggttgtgggtcccaaatgggatgtaccctggtactgcttttacaaggagtattggtgattctattgccgagact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33535966 |
agaaggtgatgatggcgatcctcctaggttgtgggtcccaaatgggatgtaccctggtactgcttttacaaggagtattggtgattctattgccgagact |
33535867 |
T |
|
| Q |
101 |
attggtgttgttgcgaatcctgagattgttagttttgaactcacacctaacaatccattttttgttattgctagtgatggtgtttttgagtttctttcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33535866 |
attggtgttgttgcgaatcctgagattgttagttttgaactcacacctaacaatccattttttgttattgctagtgatggtgtttttgagtttctttcta |
33535767 |
T |
|
| Q |
201 |
gccaaactgtggttgatatggtaaacaaaactgtttcttctcact |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33535766 |
gccaaactgtggttgatatggtaaacaaaactgtttcttttcact |
33535722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 49024505 - 49024570
Alignment:
| Q |
11 |
gatggcgatcctcctaggttgtgggtcccaaatgggatgtaccctggtactgcttttacaaggagt |
76 |
Q |
| |
|
||||| |||||||| || |||||| ||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
49024505 |
gatggtgatcctccgagattgtggctcccaaatgggatgtttcctggaactgcatttacaaggagt |
49024570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 223
Target Start/End: Complemental strand, 7066834 - 7066779
Alignment:
| Q |
168 |
ttgctagtgatggtgtttttgagtttctttctagccaaactgtggttgatatggta |
223 |
Q |
| |
|
|||| ||||||||||| |||||||| || || ||||||||||| |||||||||||| |
|
|
| T |
7066834 |
ttgcaagtgatggtgtatttgagttcctatcaagccaaactgttgttgatatggta |
7066779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University