View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7737_low_76 (Length: 229)

Name: NF7737_low_76
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7737_low_76
NF7737_low_76
[»] chr3 (1 HSPs)
chr3 (79-213)||(37762523-37762657)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 79 - 213
Target Start/End: Original strand, 37762523 - 37762657
Alignment:
79 tccccgtacatggaccgtagcgtcgacatgaatgaactactaacctcaatcgcacaagcccaaaacatcgaacaactctactccatattgtccccttaca 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
37762523 tccccgtacatggaccgtagcgtcgacatgaatgaactactaacctcaatcgcacaaacccaaaacatcgaacaactctactccatattgtccccttaca 37762622  T
179 atggcagacaactttcaattcgtttcatggtttca 213  Q
    ||||||||||||||||||||||||||||| |||||    
37762623 atggcagacaactttcaattcgtttcatgatttca 37762657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University