View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_78 (Length: 228)
Name: NF7737_low_78
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 23279691 - 23279889
Alignment:
| Q |
18 |
gtatcgattgcgatttgtttggattccactattcaacagtgccgccatggctggtatttaacaacattgatataaccaacaactataatactctttcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23279691 |
gtatcgattgcgatttgtttggattccactattcaacagtgccgccatggctggtatttaacaacattgatataaccaacaactataatactctttcaat |
23279790 |
T |
 |
| Q |
118 |
tcaaagtacataaactccgaccgaaacgcaattgatacactaaaagtgatgtcgcatccactattatccggtttgcattttaaaccctagcaacaccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23279791 |
tcaaagtacataaactccgaccgaaacgcaattgatacactaaaagtgatgtcgcatccactattatccggtttgcattttaaaccctagcaacaccaa |
23279889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 23400641 - 23400579
Alignment:
| Q |
18 |
gtatcgattgcgatttgtttggattccactattcaacagtgccgccatggctggtatttaaca |
80 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23400641 |
gtattgattgcgatttgtttggattccactattcaacagtgccgccatggctggtatttaaca |
23400579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University