View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7737_low_80 (Length: 223)
Name: NF7737_low_80
Description: NF7737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7737_low_80 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 36072743 - 36072580
Alignment:
| Q |
20 |
tgtaggagagcaaattaagctattggtggacaataaatttgctgaaaaccttgtaaggaatctcaaagctcataggaggagcaagcacacatagagacca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36072743 |
tgtaggagagcaaattaagctattggtggacaataaatttgctgacaaccttgtaaggaatctcaaagctcataggaggagcaagcacacatagagacca |
36072644 |
T |
|
| Q |
120 |
taaagcactttctttgtgatcaagtaaacatgagcaagatcattctcacctactggaagacaga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36072643 |
taaagcactttctttgtgatcaagtaaacatgagcaagatcattctcacctattggaagacaga |
36072580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 173
Target Start/End: Complemental strand, 12447416 - 12447368
Alignment:
| Q |
125 |
cactttctttgtgatcaagtaaacatgagcaagatcattctcacctact |
173 |
Q |
| |
|
||||||||| ||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
12447416 |
cactttcttcgtgatcaagtaaataagaacaagatcattctcacctact |
12447368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University