View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_high_11 (Length: 305)
Name: NF7738_high_11
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 95 - 288
Target Start/End: Original strand, 419382 - 419575
Alignment:
| Q |
95 |
ctggaatgcatgctactagttaatagctacacattgcttgagtacgttcactacccggtggagaaaaacattgagcttgaagttgttgaagggcttgggg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419382 |
ctggaatgcatgctactagttaatagctacacattgctcgagtacgttcactacccggtggagaaaaacattgagcttgaagttgttgaagggcttgggg |
419481 |
T |
|
| Q |
195 |
tttggtacgacctttgtcgaaaataatccggtggagatacggccacagtcacagaagatgtagattgagttccagactccggaggggatccttg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
419482 |
tttggtacgacctttgtcgaaaataatccggtggagatacggccacagtcacagaagatgtggattgagttccagactccggaggggatccttg |
419575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University