View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_10 (Length: 356)
Name: NF7738_low_10
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 3305754 - 3305422
Alignment:
| Q |
1 |
ttggtaaaacaattcatgcagcaccttgttcaatttccataatcctacttaaactacaaatggtacgtatcatagctagtaatttaattgcttatgctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305754 |
ttggtaaaacaattcatgcagcaccttgttcaatttccataatcctacttaaactacaaatggtacgtatcatagctagtaatttaattgcttatgctaa |
3305655 |
T |
 |
| Q |
101 |
ccgttgccacaatatattatatatgcagcatctataatgattctggatctgatcaaaatctttattaattatagtattcttcttatattattgatctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3305654 |
ccgttgccacaatatattatatatgcagcatctataatgattctggatctcatcaaaatcttt----attatagtattcttcttatattattgatctatt |
3305559 |
T |
 |
| Q |
201 |
tgtcaaatgtgattgtggacttttaatgcagattcnnnnnnnnnnnnnnnctagtgcttctttaccactagaatgcatcagctattctttgcacatttct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3305558 |
tgtcaaatgtgattgtggacttttaatgcagattctttttgattttttttctagtgcttctttaccactagaatgcatcaactattctttgcacatttct |
3305459 |
T |
 |
| Q |
301 |
tttggttactattgcaggtgttgtttttgcatttagt |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305458 |
tttggttactattgcaggtgttgtttttgcatttagt |
3305422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University