View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_14 (Length: 262)
Name: NF7738_low_14
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 3708613 - 3708396
Alignment:
| Q |
17 |
cactttcagttttactgtgccgacgtaaagaaactccnnnnnnnnttaacatggtgtgatataatattatacatatatacgtgtttgttggtttagaaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3708613 |
cactttcagttttactgtgccgacgtaaagaaactccaaaaaaaattaacatggtgtgatataatattatacatatatacgtgtttgttggtttagaaat |
3708514 |
T |
 |
| Q |
117 |
atgatttgaatgatagaaaacgatgagacatggttgtgcaggatgaaaggggacatgcaaggtcaatgctgggaccagctaggcaccatgttgaagaaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3708513 |
atgatttgaatgatagaaaacgatgagacatggttgtgcaggatgaaaggggacatgcaaggtcaatgctgggaccagctacgcaccatgttgaagaaac |
3708414 |
T |
 |
| Q |
217 |
aatggttataaacaccaa |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3708413 |
aatggttataaacaccaa |
3708396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University