View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_17 (Length: 253)
Name: NF7738_low_17
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 47502803 - 47502576
Alignment:
| Q |
18 |
atgaaacccatcaagattgctgcccacccctgcacaactcctattcaaccatgacaaatgttaattgcaactcgccatttaatgaatgta--------ac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47502803 |
atgaaacccatcaagattgctgcccacccctgcacaactcctattcaaccatgacaaatgttaattgcaactcgccatttaatgaatgtaattatgtaac |
47502704 |
T |
 |
| Q |
110 |
acnnnnnnnnnnnnnnccaatgatgttataagattgaaggtgatcataat---ctttcaactacataaatttaaacagctaaaaccatggttaatcatct |
206 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47502703 |
acttttttttttctt-ccaatgatgttataagattgaaggtgatcataataatctttcaactacataaatttaaacagctaaaaccatggttaatcatct |
47502605 |
T |
 |
| Q |
207 |
ccaaattcaagattaatgaagttcaactt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47502604 |
ccaaattcaagattaatgaagttcaactt |
47502576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University