View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_18 (Length: 241)
Name: NF7738_low_18
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 41264879 - 41265081
Alignment:
| Q |
18 |
atatcttcatactaaaaataggatcatgtttgacaagtttaaattaagagtttatagtagattgtttatagtttatattctcatacgataaaaatatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41264879 |
atatcttcatactaaaaataggatcatgtttgataagtttaaattaagagttt--------------atagtttatattctcatacgataaaaatatata |
41264964 |
T |
|
| Q |
118 |
tgatatgtaatcacttttctcactaaaatttaaattgtgtctaattcaatcttacaaaattaatttataaagtaaaaattctctctatttataaactcat |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
41264965 |
tgatacataatcacttttctcactaaaatttaaattgtgtctaattcaatcttacaaaattaatttataaagcaaaaattctctcaatttataaactcat |
41265064 |
T |
|
| Q |
218 |
gtttaggcttcatctca |
234 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
41265065 |
gtttaagcttcatctca |
41265081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University