View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_19 (Length: 234)
Name: NF7738_low_19
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 39586966 - 39586733
Alignment:
| Q |
7 |
ccttatggcgatcactggcgtaacgtccgtcgtataatctcccttgacgttctctcaacacaccgtttaaactcatttttacgtattagaaaaaacgaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586966 |
ccttatggcgatcactggcgtaacgtccgtcgtataatctcccttgacgttctctcaacacaccgtttaaactcatttttacgtattagaaaaaacgaaa |
39586867 |
T |
 |
| Q |
107 |
tcatgaaactcatgcaagccctagctcgtggttctagtt------ctagcgacggttttgcgagagtggagttgaaaacaaagctttcggagatgacttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586866 |
tcatgaaactcatgcaagccctagctcgtggttctagttctagttctagcgacggttttgtgagagtggagttgaaaacaaagctttcggagatgacttt |
39586767 |
T |
 |
| Q |
201 |
taacacgataatgagaatgatatctggaaagaga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39586766 |
taacacgataatgagaatgatatctggaaagaga |
39586733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University