View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_21 (Length: 205)
Name: NF7738_low_21
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 18013652 - 18013484
Alignment:
| Q |
17 |
aattcatcgaaggaccctttggttctatggcttaatggtggtccaggatgttctagttttgatggcttcgtatatgagcatggtaagtgtaattattttc |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18013652 |
aattcatccaaggaccctttggttctatggcttaatggtggtccaggatgttctagttttgatggcttcgtatatgagcatggtaagtgtaattattttg |
18013553 |
T |
 |
| Q |
117 |
tcattt--nnnnnnnntcttattaagaatttcaatgaaatttaagtataacctattaattgcgagatta |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18013552 |
tcatttaaaaaaaaaatcttattaagaatttcaatgaaatttaagtataatctattaattgcgagatta |
18013484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 26 - 102
Target Start/End: Complemental strand, 18023587 - 18023511
Alignment:
| Q |
26 |
aaggaccctttggttctatggcttaatggtggtccaggatgttctagttttgatggcttcgtatatgagcatggtaa |
102 |
Q |
| |
|
||||||||| | |||||||||||||||||||| || | ||||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
18023587 |
aaggaccctcttgttctatggcttaatggtggacctgcatgttctagctttgatggcttcatatatgaacatggtaa |
18023511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 102
Target Start/End: Complemental strand, 3026229 - 3026165
Alignment:
| Q |
38 |
gttctatggcttaatggtggtccaggatgttctagttttgatggcttcgtatatgagcatggtaa |
102 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
3026229 |
gttctttggcttaatggtggacctggatgttctagctttgatggattcatatatgagcatggtaa |
3026165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University