View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_6 (Length: 381)
Name: NF7738_low_6
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 72 - 256
Target Start/End: Original strand, 12457748 - 12457933
Alignment:
| Q |
72 |
cattgttaagtagtgtaagacaaagcttttatttaa-ctaagaaaatgagccccaaaatttatgtgttccacaatagataannnnnnnnnnnnnnnnata |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
12457748 |
cattgttaagtagtgtaagacaaagcttttatttaaactaagaaaatgagccccaaaatttatgtgttccacaatagaataattttttattttatttata |
12457847 |
T |
 |
| Q |
171 |
taagtacaactcagttgatagttaaagagaaatttaatacgttaaattgtgggtttaaatgtgtgattctccacggttaaataaga |
256 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12457848 |
taagtacaactcaattgatagttaaatagaaacttaatatgttaaattgtggatttaaatgtgtgattctccacggttaaataaga |
12457933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University