View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7738_low_7 (Length: 367)
Name: NF7738_low_7
Description: NF7738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7738_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 17 - 352
Target Start/End: Complemental strand, 45566065 - 45565730
Alignment:
| Q |
17 |
agtatcaagtttccattgatgaatgtcgggatgagttagatagatttaggggcagcgtgcaagcttcccaaattgggcgctctaaggaggtacatatttg |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45566065 |
agtatcgagtttccattgatgaatgtcgggatgagttagagagatttaggggcagcgtgcaagcttcccaaattgcgcgctctaaggaggtacatatttg |
45565966 |
T |
|
| Q |
117 |
aatgggaggattattggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgacaccaatgcgcgattctttcaagcc |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45565965 |
aatgagaggattattggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgataccaatgcgcgattctttcaagcc |
45565866 |
T |
|
| Q |
217 |
atggcgagtgcaaagagatgatgcaatacttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgctagct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565865 |
atggcgagtgcaaagagatgatgcaatacttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgctagct |
45565766 |
T |
|
| Q |
317 |
cctattttatgaattctgcgtgcaaagagatgatgt |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565765 |
cctattttatgaattctgcgtgcaaagagatgatgt |
45565730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 130 - 191
Target Start/End: Complemental strand, 8179449 - 8179388
Alignment:
| Q |
130 |
ttggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtga |
191 |
Q |
| |
|
|||||||||| |||||| |||||||| |||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
8179449 |
ttggcacaagaagaagcgttttggaagcaaagagctaaggtgatttggctgaaggatggtga |
8179388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University