View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_25 (Length: 446)
Name: NF7739_high_25
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 12 - 446
Target Start/End: Original strand, 15513717 - 15514151
Alignment:
| Q |
12 |
atggacatcatgtcatgtcgaccaaactttcttccttcctctacatatatcacctctctacacaactttttcataatcagcaaataatctaagtgaaatt |
111 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
15513717 |
atggacctcatgtcatatcgaccaaactttcttccttcctctacatatatcacctctctacacaactttttaataatcagcaaataatccaagtgaaatt |
15513816 |
T |
 |
| Q |
112 |
actacgtatattctctctatctcaagcaagctccatggccaataattaccccattgatcagatcaacgccttatataagatggggaagataaactccctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15513817 |
actacgtatattctctctatctcaagcaagctccatggccaataattaccccattgatcagatcaacgccttatataagatggggaagataaactccctc |
15513916 |
T |
 |
| Q |
212 |
tttggattggcaacatgtcttttattgataccaatctcggttttttcatcatcagaatcaaattgtcttcccaaatcaaacattttcatgttcacaggtt |
311 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15513917 |
tttggattggcaacatgtcttttcttgatgcaaatctcagttttttcatcatcagaatcaaattgtcttcccaaatcaaacattttcatgttcacaggtt |
15514016 |
T |
 |
| Q |
312 |
ggtcatgctgttgtttcgatttgaccgccaccctcgcgatgtgcctcatgtcaaccttcttcatccacgaagaaaaccagataagcaggttcgccttacg |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15514017 |
ggtcatgctgttgtttcgatttgaccgccaccctcgcgatgtgcctcatgtcaaccttcttcatccacgaagaaaaccagataagcaggttcgccttacg |
15514116 |
T |
 |
| Q |
412 |
cctcggtatgctgttatgtggtgctggatttgtct |
446 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15514117 |
cctcggtatgctgttatgtggtgctggatttgtct |
15514151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University