View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_40 (Length: 393)
Name: NF7739_high_40
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 32 - 379
Target Start/End: Original strand, 28099904 - 28100251
Alignment:
| Q |
32 |
gtgttaaggatatatgtgttgagaagagattcattggaacaatgtaaataactatcgcaatcgtagttgcggttatactacatgaaaagtagacatacaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28099904 |
gtgttaaggatatatgtgttgagaagagattcattggaacaatgtaaataactatcgcaatcgtagttgcggttatactacatgaaaagtagacatacaa |
28100003 |
T |
 |
| Q |
132 |
cttttgttgatctatcgtttttgtcttatactagaaccagatgattgattgcttctacacttgttctgtcgcataattttgtactgaaagaagcttcttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28100004 |
cttttgttgatctatcgtttttgtcttatactagaaccagatgattgattgcttctacacttgttctgttgcataattttgtactgaaagaagcttcttt |
28100103 |
T |
 |
| Q |
232 |
cattttggtcgtcattaatcttttgattttccattgtgtaccgaacannnnnnnctcaggagttgttgatcatttgtcttgctctttcgttttatttaag |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28100104 |
cattttggtcgtcattaatcttttgattttccattgtgtaccgaacatttttttctcaggagttgttgatcatttgtcttgctctttcgttttatttaag |
28100203 |
T |
 |
| Q |
332 |
gtgttgttgatcatgctctattatcttgctctcgtgccaaatgaaatt |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28100204 |
gtgttgttgatcatgctctattatcttgctctcgtgccaaatgaaatt |
28100251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University