View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7739_high_49 (Length: 328)

Name: NF7739_high_49
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7739_high_49
NF7739_high_49
[»] chr7 (2 HSPs)
chr7 (10-311)||(41572416-41572717)
chr7 (200-286)||(2934696-2934781)
[»] chr4 (1 HSPs)
chr4 (209-309)||(7451172-7451272)
[»] chr3 (1 HSPs)
chr3 (223-275)||(5548597-5548649)
[»] chr2 (1 HSPs)
chr2 (223-296)||(18010886-18010958)


Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 10 - 311
Target Start/End: Original strand, 41572416 - 41572717
Alignment:
10 cgtgttctagcctgatatgatagaattttagccgaattatgcatgagagtgactcgggactgctcaccccgaccgatccgtaaaatcaactgagataatt 109  Q
    |||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||    
41572416 cgtgctctagcttgatatgatagaattttagccggattatgcatgagagtgactcgggactgctcaccccgaccgattcgtaaaatcaactcagataatt 41572515  T
110 tgtatgatgcacactaaccttataagaaaaactaaatatgacttgactggtcaatcccagactatttacagactgttagttatcatagtttcccccaaga 209  Q
    |||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
41572516 tgtatgatgcacgctaacattataagaaaaactgaatatgacttgactggtcaatcccatactatttacagactgttagttatcatagtttcccccaaga 41572615  T
210 tcactatcacccaaggataggtgaaactcaatgataccttatgtctcatcccaatccatttattttcttttcagataaacaggttgcgcatgagaagggt 309  Q
    ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41572616 tcactatcacccaaggataggtggaactcactgataccttatgtctcatcccaatccatttattttcttttcagataaacaggttgcgcatgagaagggt 41572715  T
310 aa 311  Q
    ||    
41572716 aa 41572717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 286
Target Start/End: Complemental strand, 2934781 - 2934696
Alignment:
200 tcccccaagatcactatcacccaaggataggtgaaactcaatgataccttatgtctcatcccaatccatttattttcttttcagata 286  Q
    |||||| | ||||||||||||  |||||| ||| |||||| ||| || ||||||||| ||||||||| |||  ||||||||||||||    
2934781 tccccccatatcactatcaccttaggataagtggaactcactgagacattatgtctcgtcccaatcccttt-ctttcttttcagata 2934696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 309
Target Start/End: Complemental strand, 7451272 - 7451172
Alignment:
209 atcactatcacccaaggataggtgaaactcaatgataccttatgtctcatcccaatccatttattttcttttcagataaacaggttgcgcatgagaaggg 308  Q
    |||| |||||||| |||||||||| |||| | ||| ||||||||||||| |||||||| |||  ||||||||||||||   ||||||| | |||||||||    
7451272 atcattatcaccctaggataggtggaacttactgagaccttatgtctcaccccaatcctttttatttcttttcagatacgtaggttgctcgtgagaaggg 7451173  T
309 t 309  Q
    |    
7451172 t 7451172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Original strand, 5548597 - 5548649
Alignment:
223 aggataggtgaaactcaatgataccttatgtctcatcccaatccatttatttt 275  Q
    |||||||||| |||||| ||| |||||||| |||||| |||||||||||||||    
5548597 aggataggtggaactcactgagaccttatggctcatctcaatccatttatttt 5548649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 296
Target Start/End: Complemental strand, 18010958 - 18010886
Alignment:
223 aggataggtgaaactcaatgataccttatgtctcatcccaatccatttattttcttttcagataaacaggttgc 296  Q
    |||||||||| |||||| ||| || |  ||||||| |||||||| ||||||| | |||||||||||||||||||    
18010958 aggataggtggaactcactgagacatcctgtctcaccccaatccctttattt-catttcagataaacaggttgc 18010886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University