View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7739_high_51 (Length: 322)

Name: NF7739_high_51
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7739_high_51
NF7739_high_51
[»] chr1 (2 HSPs)
chr1 (28-322)||(11982943-11983237)
chr1 (223-296)||(23495617-23495690)
[»] chr8 (1 HSPs)
chr8 (28-85)||(30882869-30882926)


Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 28 - 322
Target Start/End: Original strand, 11982943 - 11983237
Alignment:
28 tttggtggtaacttggctatgaagattgatattgcaaaggcttttgatactctagactcggcctttttgcttagagttttaaaaggctttggtttttgtg 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11982943 tttggtggtaacttggctatgaagattgatattgcaaaggcttttgatactctagactcggcctttttgcttagagttttaaaaggctttggtttttgtg 11983042  T
128 acaccttctgcaactagatcaactctattctcctatcagttaggctttcagtttcaatcaatggcaggatacatggtttcttcaggtgtagtaggggagt 227  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11983043 acaccttctgcaactggatcaactctattctcctatcagttaggatttcagtttcaatcaatggcaggatacatggtttcttcaggtgtagtaggggagt 11983142  T
228 gcgacagggggatcctctgtcccctattcttttttgccttgcaaaggaagttattagtagaagcttgacaaagatggtcagagaaggaaagttga 322  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
11983143 gcgacagggggatcctctgtcccctcttcttttttgccttgcaaaggaagttattagtagaagcttgacagagatggtcagagaaggaaagttga 11983237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 296
Target Start/End: Original strand, 23495617 - 23495690
Alignment:
223 ggagtgcgacagggggatcctctgtcccctattcttttttgccttgcaaaggaagttattagtagaagcttgac 296  Q
    |||||| ||||||| |||||| | |||||| |||| ||||||||||   |||||||||||||||||| ||||||    
23495617 ggagtgagacagggagatcctttatcccctcttctcttttgccttgttgaggaagttattagtagaatcttgac 23495690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 30882926 - 30882869
Alignment:
28 tttggtggtaacttggctatgaagattgatattgcaaaggcttttgatactctagact 85  Q
    |||||||| ||||| ||| | ||| |||||||||| ||||||||||| ||||||||||    
30882926 tttggtggaaacttagctctcaaggttgatattgccaaggcttttgagactctagact 30882869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University