View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_51 (Length: 322)
Name: NF7739_high_51
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_51 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 28 - 322
Target Start/End: Original strand, 11982943 - 11983237
Alignment:
| Q |
28 |
tttggtggtaacttggctatgaagattgatattgcaaaggcttttgatactctagactcggcctttttgcttagagttttaaaaggctttggtttttgtg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11982943 |
tttggtggtaacttggctatgaagattgatattgcaaaggcttttgatactctagactcggcctttttgcttagagttttaaaaggctttggtttttgtg |
11983042 |
T |
 |
| Q |
128 |
acaccttctgcaactagatcaactctattctcctatcagttaggctttcagtttcaatcaatggcaggatacatggtttcttcaggtgtagtaggggagt |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11983043 |
acaccttctgcaactggatcaactctattctcctatcagttaggatttcagtttcaatcaatggcaggatacatggtttcttcaggtgtagtaggggagt |
11983142 |
T |
 |
| Q |
228 |
gcgacagggggatcctctgtcccctattcttttttgccttgcaaaggaagttattagtagaagcttgacaaagatggtcagagaaggaaagttga |
322 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11983143 |
gcgacagggggatcctctgtcccctcttcttttttgccttgcaaaggaagttattagtagaagcttgacagagatggtcagagaaggaaagttga |
11983237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 223 - 296
Target Start/End: Original strand, 23495617 - 23495690
Alignment:
| Q |
223 |
ggagtgcgacagggggatcctctgtcccctattcttttttgccttgcaaaggaagttattagtagaagcttgac |
296 |
Q |
| |
|
|||||| ||||||| |||||| | |||||| |||| |||||||||| |||||||||||||||||| |||||| |
|
|
| T |
23495617 |
ggagtgagacagggagatcctttatcccctcttctcttttgccttgttgaggaagttattagtagaatcttgac |
23495690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 30882926 - 30882869
Alignment:
| Q |
28 |
tttggtggtaacttggctatgaagattgatattgcaaaggcttttgatactctagact |
85 |
Q |
| |
|
|||||||| ||||| ||| | ||| |||||||||| ||||||||||| |||||||||| |
|
|
| T |
30882926 |
tttggtggaaacttagctctcaaggttgatattgccaaggcttttgagactctagact |
30882869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University