View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_76 (Length: 242)
Name: NF7739_high_76
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 11983281 - 11983506
Alignment:
| Q |
1 |
tttatatgcagatgacatgatgattttttgcaaaggaacgaattccaacatcaaagctcttaaggatgtctacttgaagtatgtagaatcttctggtcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11983281 |
tttatatgcagatgacatgatgattttttgcaaaggaacgaattccaacatcaaagctcttaaggatgtctacttgaagtatgtagaatcttctggtcaa |
11983380 |
T |
|
| Q |
101 |
atggaaaatcctcagaaatcttcaatttatgcaggctcaatcactagtcatagattgtctcaggtatctcatcaacttggttttagcattggcactctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11983381 |
atggaaaatcctcagaaatcttcaatttatgcaggctcaatcaccagtcatagattgtctcaggtatctcatcaacttggttttagcattggcactctac |
11983480 |
T |
|
| Q |
201 |
catttcaatatctaggagttccaatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11983481 |
catttcaatatctaggagttccaatt |
11983506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University