View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_77 (Length: 241)
Name: NF7739_high_77
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 25947635 - 25947427
Alignment:
| Q |
14 |
gtttggtgttctgtgcatggttctattacagaagtatgtttattaataagcttagaaactggaaactaaaataaactgtttcaattataagttttccttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25947635 |
gtttggtgttctgtgcatggttctattacagaagtatgtttattaataagcttagaaactggaaactaaaataaactgtttcaattataaattttccttc |
25947536 |
T |
|
| Q |
114 |
ttcgttgtttccatttaagcttatatgtttaagagggatgcttatattattctctgatggtattttttgctctattacctgtgaaatgtgtcttacttta |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25947535 |
ttcgttgtttccatttaagcatatatgtttaagagggatgcttatattattctctgatggtattttttgctctattacctgtgaaatgtgtcttacttta |
25947436 |
T |
|
| Q |
214 |
ttaaaaaac |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
25947435 |
ttaaaaaac |
25947427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University