View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_86 (Length: 215)
Name: NF7739_high_86
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 132
Target Start/End: Complemental strand, 22777401 - 22777284
Alignment:
| Q |
15 |
ctgtgatccgaacaattctgagattgaacgcccttccaaccaccgtgtttctccattccaacacttggaagcaaaattattaacccaacaatctgaaaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||| ||||| | ||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
22777401 |
ctgtgatccgaacaattctgagattgaacgtccttcccaccaccgtctttcttcgttccaacacctggaaacaaaactattaacccaacaatctgaaaga |
22777302 |
T |
 |
| Q |
115 |
aactcgaagaatctgaag |
132 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22777301 |
aactcgaagaatctgaag |
22777284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University