View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_high_91 (Length: 204)
Name: NF7739_high_91
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_high_91 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 43029469 - 43029299
Alignment:
| Q |
18 |
atgaagccttggaatgctattcacactgttgttattgctgttgatgttattgaagaaactattactatggctgctgaaattagcaaaccaaatagggata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029469 |
atgaagccttggaatgctattcacactgttgttattgctgttgatgttattgaagaaactattactatggctgctgaaattagcaaaccaaatagggata |
43029370 |
T |
|
| Q |
118 |
gttacggttgatcttttcaatttcttgtgatccctaatggtttcagtttcatgatcagaaaatggattaag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029369 |
gttacggttgatcttttcaatttcttgtgatccctaatggtttcagtttcatgatcagaaaatggattaag |
43029299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University