View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_101 (Length: 204)
Name: NF7739_low_101
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_101 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 185
Target Start/End: Complemental strand, 15514289 - 15514128
Alignment:
| Q |
24 |
agtagacccttacgtacttgaaaagggaaacagtaatgacccgaacaagtggaaccgcaaggaccaagacacgaaaaccatagtcaagtttgataagaat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
15514289 |
agtagacccttacgtacttgaaaagggaaacagtaatgacccgaacaagtggaactgcaagaaacaagatacgaaaaccatagccaagtttgataagaat |
15514190 |
T |
|
| Q |
124 |
gacattgcaaagcgcaatgaggaagaagaagcagccggagacaaatccagcaccacataaca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15514189 |
gacattgcaaagcgcaatgaggaagaagaagcagccggagacaaatccagcaccacataaca |
15514128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University