View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7739_low_28 (Length: 446)

Name: NF7739_low_28
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7739_low_28
NF7739_low_28
[»] chr4 (4 HSPs)
chr4 (4-110)||(56164283-56164388)
chr4 (304-391)||(49445799-49445886)
chr4 (304-376)||(55709717-55709789)
chr4 (389-428)||(49445919-49445958)


Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 4 - 110
Target Start/End: Complemental strand, 56164388 - 56164283
Alignment:
4 tgatagcaattacaaaattaagatcaaagcaatttgtcgtagcacaatgtcactgatgaactggggtttcgatgcaattatatattcatgtgatcaatca 103  Q
    ||||||||||||||||||||||||||||||||||| ||||   |||| ||||| ||||||  ||| ||||||||||||||||||||||||||||||||||    
56164388 tgatagcaattacaaaattaagatcaaagcaatttctcgtcatacaacgtcacggatgaaaaggg-tttcgatgcaattatatattcatgtgatcaatca 56164290  T
104 ataattt 110  Q
    |||||||    
56164289 ataattt 56164283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 304 - 391
Target Start/End: Original strand, 49445799 - 49445886
Alignment:
304 ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaagatgataaacgtaacag 391  Q
    |||||||||||||||| |||||| | |||||||||||| ||| ||||| ||||| || ||||||||||||||||||| ||| ||||||    
49445799 ttactttggcttctcgtgatcaattgactgctagcagcacattaaacattttggcaaggtgtcctgtacaagatgatgaacttaacag 49445886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 304 - 376
Target Start/End: Original strand, 55709717 - 55709789
Alignment:
304 ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaaga 376  Q
    ||||| ||||||||||||||||| | ||||| |||||| ||| ||||| ||||| || |||||||||||||||    
55709717 ttactctggcttctcgggatcaattgactgccagcagcacattaaacattttggcaaggtgtcctgtacaaga 55709789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 389 - 428
Target Start/End: Original strand, 49445919 - 49445958
Alignment:
389 cagaactcatatctcattgtctagctacaatgctcatgat 428  Q
    ||||||||||||||||||||||||||||| ||||||||||    
49445919 cagaactcatatctcattgtctagctacactgctcatgat 49445958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University