View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_44 (Length: 383)
Name: NF7739_low_44
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 24 - 193
Target Start/End: Original strand, 31421158 - 31421327
Alignment:
| Q |
24 |
tggtgttgtggtggtttcttcttcttctattggttcttttccttgatggtttcaatgttttcgatccggtcccgttttagtttgtcccaatctgttccag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31421158 |
tggtgttgtggtggtttcttcttcttctattggttcttttccttgagggtttcaatgttttcgatccggtcccgttttagtttgtcccgatctgttccag |
31421257 |
T |
|
| Q |
124 |
atctgactgctacgccgtacacggctgtctgctacgccggagacctctctctgttgctattcacgttttt |
193 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31421258 |
atttgactgctacaccgtacacggctgtctgctacgccggagacctctctctgttgctattcacgttttt |
31421327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 311 - 383
Target Start/End: Original strand, 31423694 - 31423766
Alignment:
| Q |
311 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtgtggctggtgatgatgt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31423694 |
agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtatggctggtgatgatgt |
31423766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University