View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_46 (Length: 374)
Name: NF7739_low_46
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 40708328 - 40708093
Alignment:
| Q |
20 |
aggtgttggggtgaattgacgagggacacaaaaagaagaatagccatagccatagccatag------tttgagcattgcattgcaaaactcataattctc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40708328 |
aggtgttggggtgaattgacgagggacacaaaaagaagaatagccatagccatagccatagccatagtttgagcattgcattgcaaaactcataattctc |
40708229 |
T |
 |
| Q |
114 |
actgtcttcacttttcactgcctttttagctcgctaatgcattgcatgcttccccaataataaagtgagagatgatgttaaggttcatcagcatcacaaa |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708228 |
actgtcttaacttttcactgcctttttagctcgctaatgcattgcatgcttccccaataataaagtgagagatgatgttaaggttcatcagcatcacaaa |
40708129 |
T |
 |
| Q |
214 |
atgggtggaccaggtttggagtaaacaacgcctttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708128 |
atgggtggaccaggtttggagtaaacaacgcctttc |
40708093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 273 - 314
Target Start/End: Complemental strand, 40708069 - 40708028
Alignment:
| Q |
273 |
aataccacgccttatattcttcctttggaaattggactagtc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708069 |
aataccacgccttatattcttcctttggaaattggactagtc |
40708028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University