View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_53 (Length: 331)
Name: NF7739_low_53
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 11 - 317
Target Start/End: Complemental strand, 41946776 - 41946470
Alignment:
| Q |
11 |
ttattctcaagagaaccaatattatcatgtacgtattgtcactgttgtaattgtcttagaggtctttcaattgcactccttactactagtgaaaaatgta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41946776 |
ttattctcaagagaaccaatattatcatatacgtattgtcactgttgtaattgtcttagaggtctttcaattgcactccttactactagtgaaaaatgta |
41946677 |
T |
 |
| Q |
111 |
gcaacagtttaactagcatattggcttgcagattaaaaatgcctaataataataacatgtgctttattacatagaagtgcttaagaacatgcatgcacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41946676 |
gcaacagtttaactagcatattggcttgcagattaaaaatgcctaataataataacatgtgctttattacatagaagtgcttaagaacatgcatgcacaa |
41946577 |
T |
 |
| Q |
211 |
tagaactcaccattttgagtgtttaattgaattctatattacatatcattaattgtataaacttttaatgtctaaaatttattaagaatcaaatctctcg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41946576 |
tagaactcaccattttgagtgtttaattgaattctatattacatatcattaattgtataaacttttaatgtctaaaatttattaaggatcaaatctctcg |
41946477 |
T |
 |
| Q |
311 |
atcacaa |
317 |
Q |
| |
|
||||||| |
|
|
| T |
41946476 |
atcacaa |
41946470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University