View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_58 (Length: 321)
Name: NF7739_low_58
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 33707704 - 33707955
Alignment:
| Q |
14 |
gctatcccagaagaaataattgagaagcctgttgggttatctttggctgaaaaagctattggtaacaatacccgatgcaatgactgtcatgccaaaggtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33707704 |
gctatcccagaagaaataattgagaagcctgttgggttatctttggctgaaaaagctattggtaacaataccagatgcaatgactgtcatgccaaaggtg |
33707803 |
T |
 |
| Q |
114 |
ccgtgctttgcgccacttgtgctggttcaggtctatatgttgactccataatggaaagtcagggcataattgttaaagttcgttgcctaggtatattctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33707804 |
ccgtgctttgcgccacttgtgctggttcaggtctatatgttgactccataatggaaagtcagggcataattgttaaagttcgttgcctaggtatattctc |
33707903 |
T |
 |
| Q |
214 |
tttcctgttcagtctcatgcaccttgcttgtgtttgaacaatacttgcagca |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33707904 |
tttcctgttcagtctcatgcaccttgcttgtgtttgaacaatacttgcagca |
33707955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University