View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_63 (Length: 305)
Name: NF7739_low_63
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 10 - 289
Target Start/End: Complemental strand, 51823091 - 51822812
Alignment:
| Q |
10 |
agaacctgtgtcaagttacacttcatggatttgggaaacaattatttctcaggaccttttccagatatttcacctcttcatgaacttgaatacctttacg |
109 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823091 |
agaaactgtgtcaagttacagttcttggatttaggaaaaaattatttctcaggaccttttccagatatttcacctcttcatgaacttgaatacctttacg |
51822992 |
T |
 |
| Q |
110 |
taaacaaaagtggattttctggaacttttccatggcaatctctgttgaatatgacaggtttgttacagttaagcgtcggagacaaccctttcgatctaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822991 |
taaacaaaagtggattttctggaacttttccatggcaatctctgttgaatatgacaggtttgttacagttaagcgtcggagacaaccctttcgatctaac |
51822892 |
T |
 |
| Q |
210 |
gccgtttcctgaagagattttaagtctcaagaagctgaattggctttacatgagtaactgcaaccttggagggaaattac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822891 |
gccgtttcctgaagagattttaagtctcaagaagctgaattggctttacatgagtaactgcaaccttggagggaaattac |
51822812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University