View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_67 (Length: 290)
Name: NF7739_low_67
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 12 - 272
Target Start/End: Original strand, 9516733 - 9516993
Alignment:
| Q |
12 |
tgttatacggtgaatccggtaccggaaaatctagctttgttgcagccatggcgaattttctttgctatgatgtatatgatgttgatctctcgaaaattca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9516733 |
tgttatacggtgaatccggtaccggaaaatctagctttgttgcagccatggcgaattttctttgctatgatgtatatgatgttgatctctcgaaaattca |
9516832 |
T |
 |
| Q |
112 |
aagcgattcagatttaaaatttctcttactagaaacatcacctaaatcgattatcgttgttgaggatctcgatcggtttatcacggcggaattggaatct |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9516833 |
aagcgattcagatttgaaatttctcttactagaaacatcacctaaatcgattatcgttgttgaggatctcgatcggtttatcacggcggaattggaatct |
9516932 |
T |
 |
| Q |
212 |
ccggcgaccgttacgtcggcggggattcagaatttcatggacgggattatgacttcgagtt |
272 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9516933 |
ccggcgaccgttacgtcggtggggattcagaatttcatggacgggattatgacttcgagtt |
9516993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University