View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_70 (Length: 273)
Name: NF7739_low_70
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 35762286 - 35762482
Alignment:
| Q |
18 |
ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762286 |
ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt |
35762385 |
T |
 |
| Q |
118 |
tgcagtgtatagaggccgtttctgtgnnnnnnnaacagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762386 |
tgcagtgtatagaggccgtttctgtgtttttttaacagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg |
35762482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University