View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_78 (Length: 255)
Name: NF7739_low_78
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_78 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 28273932 - 28273687
Alignment:
| Q |
1 |
ctttgatggtggagggggtttagttaaggtggaaagtttttgatgaatgatttggttaatgacacattcctcttatggatagaaacctttttctatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28273932 |
ctttgatggtggagggggtttagttaaggtggaaagtttttgatgaatgatttggttaatgacacattcctcttatggatagaaacctttttctatgatt |
28273833 |
T |
|
| Q |
101 |
tgttggacacttttgagtaaagaaccaatacaaaacaaaagaagtggaaaggagatgaggggaacaaaaataccagtgttgcacttgtacacataattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28273832 |
tgttggacacttttgagtaaagaaccaatacaaaacaaaagaagtggaaaggagatgaggggaacaaaaataccagtgttgcacttgtacacataattgg |
28273733 |
T |
|
| Q |
201 |
cactataatgactagtgactggccttgtgtgacaacttatattctt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28273732 |
cactataatgactagtgactggccttgtgtgacaacttattttctt |
28273687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University