View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7739_low_84 (Length: 245)
Name: NF7739_low_84
Description: NF7739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7739_low_84 |
 |  |
|
| [»] scaffold0064 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0064 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 131 - 205
Target Start/End: Complemental strand, 56598 - 56525
Alignment:
| Q |
131 |
atgtttattatttttacaacgtgtacggcgtcgaaaaccataatgttgcagcacaaattgatgtcacatttacag |
205 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56598 |
atgtttattgtttttacaacgtgt-cggcgtcaaaaaccataatgttgcagcacaaattgatgtcacatttacag |
56525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 56806 - 56706
Alignment:
| Q |
16 |
gacggagggaatattatttgaaatcctatttgtaatannnnnnncggtattatttgtaatccttaatattgcagacaatcaaagttaaatgggatcgatg |
115 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||| ||| | || |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
56806 |
gacggaggtagtattattttaaatcctatttgtaatatttttttcgggagtaactgtaatccttaatattacagagaatcaaagttaaatgggatcgatg |
56707 |
T |
 |
| Q |
116 |
c |
116 |
Q |
| |
|
| |
|
|
| T |
56706 |
c |
56706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University